Quick Order

Cynomolgus monkey FRZB ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus FRZB cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:978bp
cDNA Description:Full length Clone DNA of Macaca mulatta frizzled-related protein with C terminal His tag.
Gene Synonym:FRZB
Species:Cynomolgus
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

FRZB also known as sFRP-3, is a secreted protein containing a domain similar to the putative Wnt-binding region of the frizzled family of transmembrane receptors. FRZB is widely expressed in adult mammalian tissues. In the Xenopus gastrula, FRZB is regulated as a typical Spemann organizer component. FRZB also functions as a competitor for the cell-surface G-protein receptor Frizzled. It is espically important in embryonic development. Defects in FRZB gene can cause female-specific osteoarthritis (OA) susceptibility. FRZB may serve an important role in determining hip shape and may modify the relationship between hip shape and OA.

Size / Price
Catalog: CG90406-CH
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"