After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human KLK-13 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KLK13 cDNA Clone Product Information
Gene_bank_ref_id:NM_015596.1
RefSeq ORF Size:834bp
cDNA Description:Full length Clone DNA of Homo sapiens kallikrein-related peptidase 13 with N terminal Myc tag.
Gene Synonym:KLK13, KLKL4, KLK-L4, DKFZP586J1923
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Human tissue kallikrein 13 (hK13), also known as KLK-L4 (kallikrein-like gene 4), is a member of the human tissue kallikrein family of serine proteases having diverse physiological functions in many tissues. The KLK13 gene resides on chromosome 19q13.3-4 along with other 14 members in a gene cluster and shares a high degree of homology. KLK13 is a trypsin-like, secreted serine protease expressed specifically in the testicular tissue including prostate, salivary gland, breast, and testis. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and may play a role in metastasis. KLK13 may be involved in the pathogenesis and/or progression of breast and ovary cancers, and is regarded as a novel cancer biomarker. In addition, KLK13 interacts and forms complexes with several serum protease inhibitors, such as alpha2-macroglobulin, and its expression is regulated by steroid hormones.

Size / Price
Catalog: HG10199-NM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"