Quick Order

Text Size:AAA

Human EphB6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EPHB6cDNA Clone Product Information
Gene_bank_ref_id:NM_004445.3
cDNA Size:3021
cDNA Description:ORF Clone of Homo sapiens EPH receptor B6 DNA.
Gene Synonym:EPHB6, HEP, MGC129910, MGC129911
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ephrin & Eph Receptor Related Products
Product nameProduct name
Cynomolgus EphB1 / EPHT2 Protein (His Tag)Human EphA1 / Eph Receptor A1 Protein (His Tag, ECD)Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Mouse Ephrin B3 / EFNB3 Protein (His Tag)Mouse EphB6 Protein (His Tag)Human Ephrin-A3 / EFNA3 / EFL2 Protein (Fc Tag)Human Ephrin-A3 / EFNA3 Protein (His & Fc Tag)Human Ephrin-A3 / EFNA3 Protein (His Tag)Human Ephrin-A3 / EFNA3 ProteinHuman Ephrin-A5 / EFNA5 Protein (Fc Tag)Human Ephrin-A5 / EFNA5 Protein (His Tag)Human EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 Protein (His Tag)Human EphB6 / EphB6 ProteinHuman EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB4 / HTK ProteinHuman EphA1 / Eph Receptor A1 Protein (Fc Tag)Mouse Ephrin B3 / EFNB3 Protein (ECD, Fc Tag)Human EphB2 Protein (His & Fc Tag)Human EphB2 Protein (His Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Human EphB2 / Hek5 ProteinHuman Ephrin-B2 / EFNB2 Protein (His & Fc Tag)Human Ephrin-B2 / EFNB2 Protein (His Tag)Human Ephrin-B2 / EFNB2 ProteinHuman Ephrin-A1 / EFNA1 Protein (His & Fc Tag)Human Ephrin-A1 / EFNA1 Protein (His Tag)Human Ephrin-B1 / EFNB1 Protein (His & Fc Tag)Human Ephrin-B1 / EFNB1 Protein (His Tag)Human Ephrin-A4 / EFNA4 Protein (Fc Tag)Human EphA4 Protein (His & Fc Tag)Human EphA4 Protein (His Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Human EphA7 / EHK3 Protein (His Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Human EphB1 / EPHT2 Protein (His Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Human EphA2 Protein (His Tag)Human EphA2 Protein (aa 585-976, His & GST Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 ProteinMouse Ephrin-B1 / EFNB1 Protein (Fc Tag)Mouse Ephrin-B1 / EFNB1 Protein (His Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse EphA2 Protein (His Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse Ephrin-A1 / EFNA1 Protein (Fc Tag)Mouse Ephrin-A1 / EFNA1 Protein (His Tag)Mouse Ephrin-A3 / EFNA3 Protein (His Tag)Mouse Ephrin-A4 / EFNA4 Protein (Fc Tag)Mouse Ephrin-A4 / EFNA4 Protein (His Tag)Mouse Ephrin-A5 / EFNA5 Protein (Fc Tag)Mouse Ephrin-A5 / EFNA5 Protein (His Tag)Mouse Ephrin-B2 / EFNB2 Protein (Fc Tag)Mouse Ephrin-B2 / EFNB2 Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Mouse EphA1 / EPH receptor A1 Protein (His Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (Fc Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (His Tag)Canine Ephrin-A5 / EFNA5 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (His Tag)Rat Ephrin-A5 / EFNA5 Protein (Fc Tag)Rat Ephrin-A5 / EFNA5 Protein (His Tag)Rat Ephrin-B1 / EFNB1 Protein (Fc Tag)Rat Ephrin-B1 / EFNB1 Protein (His Tag)Rat Ephrin-B2 / EFNB2 Protein (Fc Tag)Rat Ephrin-B2 / EFNB2 Protein (His Tag)Rat EphA7 / EHK3 Protein (His Tag)Rat Ephrin-B3 / EFNB3 Protein (Fc Tag)Rat Ephrin-B3 / EFNB3 Protein (His Tag)Rat Ephrin-A1 / EFNA1 Protein (His Tag)Rat EphA4 Protein (Fc Tag) Rat EphA4 Protein (His Tag)Cynomolgus EphA4 Protein (Fc Tag)Cynomolgus EphA4 Protein (His Tag)Cynomolgus Ephrin-A5 / EFNA5 Protein (Fc Tag)Cynomolgus Ephrin-A5 / EFNA5 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Mouse EphB2 / Hek5 Protein (His Tag)Cynomolgus EphB1 / EPHT2 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (Fc Tag)
Background

Ephrins are divided into the ephrin-A (EFNA) class and the ephrin-B (EFNB) class based on their structures and sequence relationships. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. EphB6 is an unusual Eph receptor, lacking catalytic capacity due to alterations in its kinase domain. Interestingly, increased metastatic activity is associated with reduced EphB6 receptor expression in several tumor types, including breast cancer. This emphasizes the potential of EphB6 to act as a suppressor of cancer aggressiveness. EphB6 suppress cancer invasiveness through c-Cbl-dependent signaling, morphologic changes, and cell attachment and indicate that EphB6 may represent a useful prognostic marker and a promising target for therapeutic approaches. EphB6 can both positively and negatively regulate cell adhesion and migration, and suggest that tyrosine phosphorylation of the receptor by an Src family kinase acts as the molecular switch for the functional transition. In addition, Ephrin-B2 may be a physiological ligand for the EphB6 receptor.

References
  • Munthe E, et al. (2000)Ephrin-B2 is a candidate ligand for the Eph receptor, EphB6. FEBS Lett. 466(1): 169-74.
  • Matsuoka H, et al. (2005) Biphasic functions of the kinase-defective Ephb6 receptor in cell adhesion and migration. J Biol Chem. 280(32): 29355-63.
  • Truitt L, et al. (2010) The EphB6 receptor cooperates with c-Cbl to regulate the behavior of breast cancer cells. Cancer Res. 70(3): 1141-53.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"