After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BCL2cDNA Clone Product Information
Gene_bank_ref_id:NM_000633.2
cDNA Size:720
cDNA Description:ORF Clone of Homo sapiens B-cell CLL/lymphoma 2, nuclear gene encoding mitochondrial protein, transcript variant alpha DNA.
Gene Synonym:BCL2
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10195-ACG$325
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10195-ACR$325
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10195-ANG$325
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10195-ANR$325
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10195-CF$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10195-CH$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10195-CM$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10195-CY$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone)HG10195-M$95
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10195-NF$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10195-NH$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10195-NM$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10195-NY$295
Human Bcl-2 / BCL2 transcript variant alpha Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10195-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

BCL2 (B-cell leukemia/lymphoma 2, N-Histidine-tagged), also known as Bcl-2, belongs to the Bcl-2 family. Bcl-2 family proteins regulate and contribute to programmed cell death or apoptosis. It is a large protein family and all members contain at least one of four BH (bcl-2 homology) domains. Certain members such as Bcl-2, Bcl-xl and Mcl1 are anti-apoptotic, whilst others are pro-apoptotic. Most Bcl-2 family members contain a C-terminal transmembrane domain that functions to target these proteins to the outer mitochondrial and other intracellular membranes. It is expressed in a variety of tissues. BCL2 blocks the apoptotic death of some cells such as lymphocytes. It also regulates cell death by controlling the mitochondrial membrane permeability and inhibits caspase activity either by preventing the release of cytochrome c from the mitochondria and/or by binding to the apoptosis-activating factor. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Two transcript variants, produced by alternate splicing, differ in their C-terminal ends.

References
  • Tsujimoto Y, et al. (1984) Cloning of the chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome translocation. Science. 226(4678):1097-99.
  • Cleary ML, et al. (1986) Cloning and structural analysis of cDNAs for bcl-2 and a hybrid bcl-2/immunoglobulin transcript resulting from the t(14;18) translocation. Cell. 47(1):19-28.
  • Otake Y, et al. (2007) Overexpression of nucleolin in chronic lymphocytic leukemia cells induces stabilization of Bcl-2 / Bcl-2 mRNA. Blood. 109(7):3069-75.
  • Size / Price
    Catalog:HG10195-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"