After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SULT1E1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SULT1E1cDNA Clone Product Information
Gene_bank_ref_id:NM_005420.2
cDNA Size:885
cDNA Description:ORF Clone of Homo sapiens sulfotransferase family 1E, estrogen-preferring, member 1 DNA.
Gene Synonym:EST, STE, EST-1, MGC34459, SULT1E1
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human SULT1E1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Related Products
Product nameProduct name
Background

Estrogen sulfotransferase, also known as Sulfotransferase, estrogen-preferring, Sulfotransferase 1E1, SULT1E1 and ST1E1, is a cytoplasm enzyme which belongs to the sulfotransferase 1 family. Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. SULT1E1 may control the level of the estrogen receptor by sulfurylating free estradiol. SULT1E1 maximally sulfates beta-estradiol and estrone at concentrations of 20 nM. SULT1E1 also sulfates dehydroepiandrosterone, pregnenolone, ethinylestradiol, equalenin, diethylstilbesterol and 1-naphthol, at significantly higher concentrations; however, cortisol, testosterone and dopamine are not sulfated. SULT1E1 is a key enzyme in estrogen homeostasis. It plays a central role in the prevention and development of human disease.

References
  • Bernier F, et al.,1994, J Biol Chem. 269 (45): 28200-5.
  • Strausberg RL, et al.,2003, Proc. Natl. Acad. Sci. 99 (26): 16899-903.
  • Cole,GB. et al., 2010, Proc Natl Acad Sci USA. 107 (14): 6222-7.
  • Size / Price
    Catalog:HG11275-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"