Quick Order

Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
S100A2cDNA Clone Product Information
Gene_bank_ref_id:NM_005978.3
cDNA Size:294
cDNA Description:ORF Clone of Homo sapiens S100 calcium binding protein A2 DNA.
Gene Synonym:S100A2, CAN19, S100L, MGC111539
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10180-ACG$325
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10180-ACR$325
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10180-ANG$325
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10180-ANR$325
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10180-CF$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10180-CH$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10180-CM$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10180-CY$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone)HG10180-M$95
Human S100A2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10180-M-F$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10180-M-N$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10180-NF$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10180-NH$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10180-NM$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10180-NY$295
Human S100A2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10180-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

The calcium-binding Protein S100A2 is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 family genes are located as a cluster on chromosome 1q21, and S100 proteins consisting of at least 20 members are involved in the regulation of a number of cellular processes such as cell-cycle progression and cell differentiation. S100A2 was first detected in lung and kidney, and is mainly expressed in a subset of tissues and cells such as breast epithelia and liver. The S100A2 protein is a homodimer that undergoes a conformational change upon binding of calcium, and the active form functions in regulating cell proliferation and differentiation, gene transcription, and p53-dependent growth arrest and apoptosis. Accordingly, this protein is regarded as a putative tumor suppressor, and thus chromosomal rearrangements and reduced expression of S100A2 gene have been implicated in certain carcinomas.

References
  • Gimona, M. et al., 1997, J. Cell. Sci. 110: 611-621.
  • Mueller, A. et al., 2005, J. Biol. Chem. 280: 29186-29193.
  • Lapi, E. et al., 2006, Oncogene. 25: 3628-3637.
  • Feng, G. et al., 2001, Cancer. Res. 61: 7999-8004.
  • Gupta, S. et al., 2003, J. Clin. Oncol. 21: 106-112.
  • Size / Price
    Catalog:HG10180-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"