After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human Dkk1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
DKK1cDNA Clone Product Information
Gene_bank_ref_id:NM_012242.2
cDNA Size:801
cDNA Description:ORF Clone of Homo sapiens dickkopf homolog 1 (Xenopus laevis) DNA.
Gene Synonym:SK, DKK-1
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Dickkopf (DKK) family proteins, consisting of DKK-1, DKK-2, DKK-3 and DKK-4, function as secreted Wnt antagonists by inhibiting Wnt coreceptors LRP5/6. DKK-1, DKK-2, and DKK-4 also bind cell surface Kremen-1 or Kremen-2 and promote the internalization of LRP5/6. Dickkopf related protein 1 (DKK-1) was initially identified as an inducer of head formation in Xenopus embryos. DKK-1 protein modulates Wnt signaling pathway during embryonic development. Increased levels of DKK-1 are found in the majority of lung cancers, esophageal squamous cell carcinomas, and hormone-resistant breast cancers, while DKK-1 expression is decreased in malignant melanoma and colorectal cancers.

References
  • Horwitz EM. (2004) Dkk-1-mediated expansion of adult stem cells. Trends Biotechnol. 22(8): 386-8.
  • Jiang T, et al. (2009) Clinical significance of serum DKK-1 in patients with gynecological cancer. Int J Gynecol Cancer. 19(7): 1177-81.
  • Size / Price
    Catalog:HG10170-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"