Quick Order

Text Size:AAA

Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CNDP2cDNA Clone Product Information
Gene_bank_ref_id:NM_018235.1
cDNA Size:1428
cDNA Description:ORF Clone of Homo sapiens CNDP dipeptidase 2 (metallopeptidase M20 family) DNA.
Gene Synonym:CNDP2, CN2, CPGL, PEPA, HsT2298, FLJ10830
Species:Human
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10168-ACG$325
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10168-ACR$325
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10168-ANG$325
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10168-ANR$325
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10168-CF$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10168-CH$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10168-CM$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10168-CY$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone)HG10168-M$95
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10168-M-N$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10168-NF$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10168-NH$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10168-NM$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10168-NY$295
Human CNDP2 / CPGL Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10168-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Mouse cytosolic non-specific dipeptidase, also known as CNDP dipeptidase 2, Glutamate carboxypeptidase-like protein 1, Peptidase A, CNDP2 and CN2, is a cytoplasm protein which belongs to the peptidase M20A family. CNDP2 / CPGL is a cytosolic enzyme that can hydrolyze carnosine to yield l-histidine and beta-alanine. CNDP2 / CPGL hydrolyzes a variety of dipeptides including L-carnosine but has a strong preference for Cys-Gly. It may be play a role as tumor suppressor in hepatocellular carcinoma (HCC) cells. Isoform 1 of CNDP2 / CPGL is ubiquitously expressed with higher levels in kidney and liver (at protein level). Isoform 2 of CNDP2 / CPGL is expressed in fetal tissues, it is only expressed in adult liver and placental tissues. CNDP2 / CPGL is highly expressed in the histaminergic neurons in the tuberomammillary nucleus, implying that it may supply histidine to histaminergic neurons for histamine synthesis.

References
  • Bakker,SJ. et al., 2008, Diabetes  57 (12):e16; author reply e17. 
  • Wanic, K. et al., 2008, Diabetes  57 (9): 2547-51.
  • McDonough,CW. et al., 2009, Hum Genet 126 (2): 265-75.
  • Kaur,H. et al., 2009, J Biol Chem. 284 (21):14493-502.
  • Size / Price
    Catalog:HG10168-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"