Quick Order

Human CES3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CES3cDNA Clone Product Information
cDNA Size:1716
cDNA Description:ORF Clone of Homo sapiens carboxylesterase 3 DNA.
Gene Synonym:ES31, FLJ21736, CES3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Carboxylesterases hydrolyze esters of short-chain fatty acids and have roles in animals ranging from signal transduction to xenobiotic detoxification. In enzymology, a carboxylesterase is an enzyme that catalyzes the chemical reaction: a carboxylic ester + H2O = an alcohol + a carboxylate. Most enzymes from this group belong to the superfamily of hydrolases with alpha/beta protein fold (so called Alpha/beta hydrolase fold), specifically those acting on carboxylic ester bonds. The carboxylesterase family of evolutionarily related proteins (those with clear sequence homology to each other) includes a number of proteins with different substrate specificities, such as acetylcholinesterases. Carboxylesterase 3, also known as Liver carboxylesterase 31 homolog and CES3, is a endoplasmic reticulum lumen which belongs to the type-B carboxylesterase/lipase family. CES3 is involved in the detoxification of xenobiotics and in the activation of ester and amide prodrugs. CES3 shows low catalytic efficiency for hydrolysis of CPT-11, a prodrug for camptothecin used in cancer therapeutics. CES3 is expressed in liver, colon and small intestine.

  • Augusteyn RC. et al.,1969, Biochim Biophys Acta. 171 (1): 128-37.
  • Saito S. et al., 2003, J. Hum. Genet. 48: 249-70.
  • Sanghani SP. et al., 2003, Clin Cancer Res. 9: 4983-91.
  • Sanghani SP. et al., 2004, Drug Metab Dispos. 32: 505-11.
  • Chen R. et al., 2009, J Proteome Res. 8: 651-61.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items