After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human IGF2BP2 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IGF2BP2 cDNA Clone Product Information
Gene_bank_ref_id:NM_006548.4
RefSeq ORF Size:1800bp
cDNA Description:Full length Clone DNA of Homo sapiens insulin-like growth factor 2 mRNA binding protein 2 with C terminal Myc tag.
Gene Synonym:p62, IMP2, IMP-2, VICKZ2
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Background

Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) is a member of the IGF-II mRNA-binding protein (IMP) family. IGF2BP2 is a member of a family of mRNA binding proteins that, collectively, have been shown to bind to several different mRNAs in mammalian cells, including one of the mRNAs encoding insulin-like growth factor-2. Insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) is involved in the stimulation of insulin action. IGF2BP2 / IMP2 is expressed in oocytes, granulosa cells of small and growing follicles, Leydig cells, spermatogonia and semen (at protein level). It is also expressed in testicular cancer (at protein level). It is expressed weakly in heart, placenta, skeletal muscle, bone marrow, colon, kidney, salivary glands, testis and pancreas. IGF2BP2 binds to the 5'-UTR of the insulin-like growth factor 2 (IGF2) mRNAs. This binding is isoform-specific. IGF2BP2 may regulate translation of target mRNAs.

References
  • Omori S, et al. (2008) Association of CDKAL1, IGF2BP2, CDKN2A/B, HHEX, SLC30A8, and KCNJ11 with susceptibility to type 2 diabetes in a Japanese population. Diabetes. 57(3): 791-5.
  • Grarup N, et al. (2007) Studies of association of variants near the HHEX, CDKN2A/B, and IGF2BP2 genes with type 2 diabetes and impaired insulin release in 10,705 Danish subjects: validation and extension of genome-wide association studies. Diabetes. 56(12): 3105-11.
  • Wu Y, et al. (2008) Common variants in CDKAL1, CDKN2A/B, IGF2BP2, SLC30A8, and HHEX/IDE genes are associated with type 2 diabetes and impaired fasting glucose in a Chinese Han population. Diabetes. 57(10): 2834-42.
  • Size / Price
    Catalog: HG11116-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"