Quick Order

Cynomolgus monkey CD8B Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD8BcDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:624
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) t-cell surface glycoprotein CD8 beta chain-like DNA.
Gene Synonym:CD8B
Species:Cynomolgus
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

CD8B (CD8b molecule), also known as P37 and LEU2, contains 1 Ig-like V-type (immunoglobulin-like) domain. The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen, acting as a coreceptor, and the T-cell receptor on the T lymphocyte recognize antigens displayed by an antigen presenting cell (APC) in the context of class I MHC molecules. The functional coreceptor is either a homodimer composed of two alpha chains, or a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. P37 gene encodes the CD8 beta chain isoforms. Multiple alternatively spliced transcript variants encoding distinct membrane associated or secreted isoforms have been described. A pseudogene, also located on chromosome 2, has been identified. CD8 is thought to play a role in the process of T-cell mediated killing.

References
  • Leahy DJ, et al. (1992) Crystal structure of a soluble form of the human T cell coreceptor CD8 at 2.6 A resolution. Cell. 68(6):1145-62.
  • Gao G, et al. (2000) Molecular interactions of coreceptor CD8 and MHC class I: the molecular basis for functional coordination with the T-cell receptor. Immunol Today. 21(12):630-6.
  • Devine L, et al. (1999) Orientation of the Ig domains of CD8 alpha beta relative to MHC class I. J Immunol. 162(2):846-51.
  • Size / Price
    Catalog:CG90178-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"