Quick Order

Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ACBD6cDNA Clone Product Information
cDNA Size:849
cDNA Description:ORF Clone of Homo sapiens acyl-Coenzyme A binding domain containing 6 DNA.
Gene Synonym:MGC2404, ACBD6
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11112-ACG$325
Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11112-ACR$325
Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG11112-ANG$325
Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG11112-ANR$325
Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11112-CF$295
Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11112-CH$295
Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11112-CM$295
Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11112-CY$295
Human ACBD6 Gene cDNA Clone (full-length ORF Clone)HG11112-M$95
Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11112-M-F$295
Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11112-M-N$295
Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11112-NF$295
Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11112-NH$295
Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11112-NM$295
Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11112-NY$295
Human ACBD6 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11112-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Human acyl-coenzyme A binding domain-containing member 6 (ACBD6) is a modular protein that carries an acyl-CoA binding domain at its N terminus and two ankyrin motifs at its C terminus. In mammals, there are six members of the acyl-CoA binding domain-containing (ACBD) family, and their annotation is not uniform. All six ACBD proteins contain an ACB domain at the N terminus, but they do not share significant homology at the C-terminal region. ACBD6 is a 32 kDa protein that is predicted by sequence analysis to carry an ACB domain between residues 42 and 125 and two ANK motifs at its C terminus. This protein binds long-chain acyl-CoAs with a strong preference for unsaturated, C18:1-CoA and C20:4-CoA, over saturated, C16:0-CoA, acyl species. ACBD6 is not a ubiquitous protein, but it is expressed in hematopoietic tissues and appears to be restricted to primitive stem cells present in those tissues with functions in blood and vessel development. ACBD6 was detected in bone marrow, spleen, placenta, cord blood, circulating CD34+ progenitors, and embryonic-like stem cells derived from placenta. In placenta, the protein was only detected in CD34+ progenitor cells present in blood and in CD31+ endothelial cells surrounding the blood vessels. These cells were also positive for the marker CD133, and they probably constitute hemangiogenic stem cells, precursors of both blood and vessels. We propose that human ACBD6 represents a cellular marker for primitive progenitor cells with functions in hematopoiesis and vascular endothelium development.

  • Soupene E, et al. (2008) Characterization of an acyl-coenzyme A binding protein predominantly expressed in human primitive progenitor cells. J Lipid Res. 49(5): 1103-12.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks