After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey SELL Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SELLcDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:1119
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) selectin L DNA.
Gene Synonym:SELL
Species:Cynomolgus
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

L-selectin (SELL), also known as CD62L, is a key adhesion molecule that regulates both the migration of leukocytes at sites of inflammation and the recirculation of lymphocytes between blood and lymphoid tissues. It belongs to the selectin family of proteins, and consisting of a large, highly glycosylated, extracellular domain, a single spanning transmembrane domain and a small cytoplasmic tail. L-selectin is the only selectin expressed on leukocytes and mediates a number of leukocyte-endothelial interactions. L-selectin acts as a "homing receptor" for leukocytes to enter secondary lymphoid tissues via high endothelial venules. Ligands present on endothelial cells will bind to leukocyte expressing L-selectin, slowing leukocyte trafficking through the blood, and facilitating entry into a secondary lymphoid organ at that point. L-selectin-mediated lymphocyte recirculation is required for maintaining the appropriate tissue distribution of lymphocyte subpopulations including naïve and effector subsets such as regulatory T cells. In addition, L-selectin-mediated entry into peripheral lymph nodes is required for optimal induction of lymphocyte homeostatic proliferation during lymphopenia. Importantly, L-selectin has been shown to have both adhesive and signaling functions during leukocyte migration. L-selectin has also been shown to mediate leukocyte recruitment during chronic inflammatory and autoimmune diseases and thus is a potential therapeutic target for drug development.

References
  • Smalley DM, et al. (2005) L-selectin: mechanisms and physiological significance of ectodomain cleavage. J Cell Mol Med. 9(2): 255-66.
  • Grailer JJ, et al. (2009) L-selectin: role in regulating homeostasis and cutaneous inflammation. J Dermatol Sci. 56(3): 141-7.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"