Quick Order

Cynomolgus monkey FCN1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
FCN1cDNA Clone Product Information
cDNA Size:981
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ficolin (collagen/fibrinogen domain containing) 1 DNA.
Gene Synonym:FCN1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

Ficolins are humoral molecules of the innate immune systems which recognize carbohydrate molecules on pathogens, apoptotic and necrotic cells. The Ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. Ficolins are humoral molecules of the innate immune systems which recognize carbohydrate molecules on pathogens, apoptotic and necrotic cells. Three Ficolins have been identified in humans: L-Ficolin, H-Ficolin and M-Ficolin (also referred to as Ficolin-2, -3 and -1, respectively). They are soluble oligomeric defence proteins with lectin-like activity and they are structurally similar to the human collectins, mannan-binding lectin (MBL) and surfactant protein A and D. Dysfunction or abnormal expressions of Ficolins may involved in the pathogenesis of human diseases including infectious and inflammatory diseases, autoimmune disease and clinical syndrome of preeclampsia. They are soluble oligomeric defence proteins with lectin-like activity and they are structurally similar to the human collectins, mannan-binding lectin (MBL) and surfactant protein A and D. Upon recognition of the infectious agent, the Ficolins act through two distinct routes: initiate the lectin pathway of complement activation through attached serine proteases (MASPs), and a primitive opsonophagocytosis thus limiting the infection and concurrently orchestrating the subsequent adaptive clonal immune response. Ficolin-1 (FCN1) is predominantly expressed in the peripheral blood leukocytes.

  • Thiel S. (2007) Complement activating soluble pattern recognition molecules with collagen-like regions, mannan-binding lectin, ficolins and associated proteins. Mol Immunol. 44(16): 3875-88.
  • Zhang XL, et al. (2008) Ficolins: structure, function and associated diseases. Adv Exp Med Biol. 632: 105-15.
  • Garred P, et al. (2009) MBL2, FCN1, FCN2 and FCN3-The genes behind the initiation of the lectin pathway of complement. Mol Immunol. 46(14): 2737-44.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items