Quick Order

Text Size:AAA

Human RSPO1 ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human RSPO1 cDNA Clone Product Information
NCBI RefSeq:NM_001038633.2
RefSeq ORF Size:792bp
cDNA Description:Full length Clone DNA of Homo sapiens R-spondin homolog (Xenopus laevis) with C terminal Myc tag.
Gene Synonym:RSPO, CRISTIN3, FLJ40906, RP11-566C13.1, RSPO1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:pCMV3-RSPO1-Myc
Restriction Site:KpnI + XbaI (6kb + 0.84kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human RSPO1 Gene Plasmid Map
Human RSPO1 ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Background

RSPO1 gene is a member of the R-spondin family. It encodes RSPO1 which is known as a secreted activator protein with two cystein-rich, furin-like domains and one thrombospondin type 1 domain. In mice, RSPO1 induces the rapid onset of crypt cell proliferation and increases intestinal epithelial healing, providing a protective effect against chemotherapy-induced adverse effects. This protein is an activator of the beta-catenin signaling cascade, leading to TCF-dependent gene activation. RSPO1 acts both in the canonical Wnt/beta-catenin-dependent pathway and in non-canonical Wnt signaling pathway, probably by acting as an inhibitor of ZNRF3, an important regulator of the Wnt signaling pathway. It also acts as a ligand for frizzled FZD8 and LRP6.

References
  • Kamata T, et al. (2004) R-spondin, a novel gene with thrombospondin type 1 domain, was expressed in the dorsal neural tube and affected in Wnts mutants. Biochim Biophys Acta. 1676(1):51-62.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Size / Price
    Catalog: HG11083-CM
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"