After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human VLDLR ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VLDLR cDNA Clone Product Information
Gene_bank_ref_id:NM_003383.3
RefSeq ORF Size:2622bp
cDNA Description:Full length Clone DNA of Homo sapiens very low density lipoprotein receptor with C terminal Myc tag.
Gene Synonym:CHRMQ1, VLDLRCH, FLJ35024, VLDLR
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

The very low density lipoprotein receptor, known as VLDLR, is a single-pass type 1 integral membrance protein and a member of the LDL receptor family. This receptor family includes LDL receptor, LRP, megalin, VLDLR and ApoER2, and is characterized by a cluster of cysteine-rich class A repeats, epidermal growth factor (EGF)-like repeats, YWTD repeats and an O-linked sugar domain. VLDLR contains 3 EGF-like domains, 8 LDL-receptor class A domains, as well as 6 LDL-receptor class B repeats, and is abundant in heart, skeletal muscle, also ovary and kidney, but not in liver. VLDLR binds VLDL and transports it into cells by endocytosis. In order to be internalized, the receptor-ligand complexes must first cluster into clathrin-coated pits. VLDLR mediates the phosphorylation of mDab1 (mammalian disabled protein) via binding to Reelin, and induces the modulation of Tau phosphorylation. This pathway regulates the migration of neurons along the radial glial fiber network during brain development. Defects of VLDLR may be the cause of VLDLR-associated cerebellar hypoplasia (VLDLRCH), a syndrome characterized by moderate-to-profound mental retardation, delayed ambulation, and predominantly truncal ataxia.

References
  • Trommsdorff, M. et al., 1999. Cell. 97: 689-701.
  • Mikhailenko, I. et al., 1999. J. Cell Sci. 112: 3269-3281.
  • Sato, A. et al., 1999. Biochem. J. 341: 377-383.
  • Hiesberger, T. et al., 1999. Neuron 24: 481-489.
  • Tiebel, O. et al., 1999. Atherosclerosis 145: 239-251.
  • Boycott, K.M. et al., 2005, Am. J. Hum. Genet. 77 (3): 477-483. 
  • Moheb, L.A. et al., 2008, Eur. J. Hum. Genet. 16 (2): 270-273.
  • Size / Price
    Catalog: HG11075-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"