Quick Order

Human GFPT1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GFPT1cDNA Clone Product Information
cDNA Size:2046
cDNA Description:ORF Clone of Homo sapiens glutamine-fructose-6-phosphate transaminase 1 DNA.
Gene Synonym:GFA, GFAT, GFPT, GFAT1, GFAT1m, GFPT1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Glutamine:fructose-6-phosphate amidotransferase 1 (GFAT), also known as GFPT1, is a member of the N-terminal nucleophile aminotransferases and the first rate-limiting enzyme for the entry of glucose into the hexosamine biosynthesis pathway (HBP) in mammals. GFAT transfers the amino group from the L-glutamine amide to the D-fructose 6-phosphate, producing glutamic acid and glucosamine 6-phosphate. GFAT exists as a homotetramer in cytoplasm, and is proposed to be most likely involved in regulating the availability of precursors for N- and O-linked glycosylation of proteins. The full length of human GFAT contains 1 glutamine amidotransferase type-2 domain which catalyzes amide nitrogen transfer from glutamine to the appropriate substrate, and 2 SIS (Sugar Isomerase) domains found in many phosphosugar isomerases and phosphosugar binding proteins.Two isoforms of gfat have been identified: GFAT1 is predominantly expressed in skeletal muscle, whereas GFAT2 is expressed mainly in the central nervous system.

Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items