After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Ferret UBE2L6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
UBE2L6cDNA Clone Product Information
cDNA Size:462
cDNA Description:ORF Clone of Mustela putorius furo (sub-species: furo) ubiquitin-conjugating enzyme E2L 6 DNA.
Gene Synonym:UBE2L6
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ferret UBE2L6 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name

UBCH8, also known as UBE2L6, belongs to the ubiquitin-conjugating enzyme family. The family of ubiquitin-conjugating (E2) enzymes is characterized by the presence of a highly conserved ubiquitin-conjugating (UBC) domain. These domains accommodate the ATP-activated ubiquitin (Ub) or ubiquitin-like (UBL) protein via a covalently linked thioester onto its active-site residue. E2 enzymes act via selective protein-protein interactions with the E1 and E3 enzymes and connect activation to covalent modification. By doing so, E2s differentiate effects on downstream substrates, either with a single Ub/UBL molecule or as a chain. UBCH8 is highly similar in primary structure to the enzyme encoded by the UBE2L3 gene. It catalyzes the covalent attachment of ubiquitin or ISG15 to other proteins. UBCH8 functions in the E6/E6-AP-induced ubiquitination of p53/TP53 and promotes ubiquitination and subsequent proteasomal degradation of FLT3. At protein level, it is present in natural killer cells.

  • Moynihan TP, et al. (1999) The ubiquitin-conjugating enzymes UbcH7 and UbcH8 interact with RING finger/IBR motif-containing domains of HHARI and H7-AP1. J Biol Chem. 274(43):30963-8.
  • Ardley HC, et al. (2000) Genomic organization of the human ubiquitin-conjugating enzyme gene, UBE2L6 on chromosome 11q12. Cytogenet Cell Genet. 89(1-2):137-40.
  • Zhao C, et al. (2004) The UbcH8 ubiquitin E2 enzyme is also the E2 enzyme for ISG15, an IFN-alpha/beta-induced ubiquitin-like protein. Proc Natl Acad. 101(20):7578-82.
  • Tripathi MK, et al. (2005) Down-regulation of UCRP and UBE2L6 in BRCA2 knocked-down human breast cells. Biochem Biophys Res Commun. 328(1):43-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items