Quick Order

Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDH2cDNA Clone Product Information
cDNA Size:2721
cDNA Description:ORF Clone of Homo sapiens cadherin 2, type 1, N-cadherin (neuronal) DNA.
Gene Synonym:CDHN, NCAD, CD325, CDw325, CDH2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11039-ACG$425
Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11039-ACR$425
Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11039-CF$395
Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11039-CH$395
Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11039-CM$395
Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11039-CY$395
Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone)HG11039-G$195
Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11039-G-F$445
Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11039-G-N$445
Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11039-NF$395
Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11039-NH$395
Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11039-NM$395
Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11039-NY$395
Human CDH2 / NCAD / CD325 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11039-UT$395
 Learn more about expression Vectors
Related Products
Product nameProduct name

Cadherins are calcium dependent cell adhesion proteins, and they preferentially interact with themselves in a homophilic manner in connecting cells. Cadherin 2 (CDH2), also known as N-Cadherin (neuronal) (NCAD), is a single-pass tranmembrane protein and a cadherin containing 5 cadherin domains. N-Cadherin displays a ubiquitous expression pattern but with different expression levels between endocrine cell types. CDH2 (NCAD) has been shown to play an essential role in normal neuronal development, which is implicated in an array of processes including neuronal differentiation and migration, and axon growth and fasciculation. In addition, N-Cadherin expression was upregulated in human HSC during activation in culture, and function or expression blocking of N-Cadherin promoted apoptosis. During apoptosis, N-Cadherin was cleaved into 20-100 kDa fragments. It may provide a novel target for therapies that are directed toward intimal proliferative disorders, including restenosis and vascular bypass graft failure. N-Cadherin is associated with tumor aggressiveness and metastatic potential and may contribute to tumor progression.

  • Jones M, et al. (2002) N-cadherin upregulation and function in response of smooth muscle cells to arterial injury. Arterioscler Thromb Vasc Biol. 22(12): 1972-7.
  • Nagi C, et al. (2005) N-cadherin expression in breast cancer: correlation with an aggressive histologic variant--invasive micropapillary carcinoma. Breast Cancer Res Treat. 94(3): 225-35.
  • Schrick C, et al. (2007) N-cadherin regulates cytoskeletally associated IQGAP1/ERK signaling and memory formation. Neuron. 55(5): 786-98.
  • Li K, et al. (2010) Downregulation of N-cadherin expression inhibits invasiveness, arrests cell cycle and induces cell apoptosis in esophageal squamous cell carcinoma. Cancer Invest. 28(5): 479-86.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items