Quick Order

Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD8BcDNA Clone Product Information
cDNA Size:633
cDNA Description:ORF Clone of Homo sapiens CD8b molecule, transcript variant 1 DNA.
Gene Synonym:Ly3, LYT3, Leu2, CD8B1, MGC119115
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG11031-ACG$325
Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG11031-ACR$325
Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG11031-CF$295
Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG11031-CH$295
Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG11031-CM$295
Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG11031-CY$295
Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone)HG11031-M$95
Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG11031-M-F$295
Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone) expression ready, untaggedHG11031-M-N$295
Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG11031-NF$295
Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG11031-NH$295
Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG11031-NM$295
Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG11031-NY$295
Human CD8B transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG11031-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

CD8B (CD8b molecule), also known as P37 and LEU2, contains 1 Ig-like V-type (immunoglobulin-like) domain. The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen, acting as a coreceptor, and the T-cell receptor on the T lymphocyte recognize antigens displayed by an antigen presenting cell (APC) in the context of class I MHC molecules. The functional coreceptor is either a homodimer composed of two alpha chains, or a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. P37 gene encodes the CD8 beta chain isoforms. Multiple alternatively spliced transcript variants encoding distinct membrane associated or secreted isoforms have been described. A pseudogene, also located on chromosome 2, has been identified. CD8 is thought to play a role in the process of T-cell mediated killing.

  • Leahy DJ, et al. (1992) Crystal structure of a soluble form of the human T cell coreceptor CD8 at 2.6 A resolution. Cell. 68(6):1145-62.
  • Gao G, et al. (2000) Molecular interactions of coreceptor CD8 and MHC class I: the molecular basis for functional coordination with the T-cell receptor. Immunol Today. 21(12):630-6.
  • Devine L, et al. (1999) Orientation of the Ig domains of CD8 alpha beta relative to MHC class I. J Immunol. 162(2):846-51.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items