After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CROT ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CROT cDNA Clone Product Information
Gene_bank_ref_id:NM_021151.2
RefSeq ORF Size:1839bp
cDNA Description:Full length Clone DNA of Homo sapiens carnitine O-octanoyltransferase with C terminal Myc tag.
Gene Synonym:ARP2, HARP, MGC8889, ANGPTL2
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Carnitine octanoyltransferase (CROT or COT), also known as octanoyl-CoA: L-carnitine O-octanoyltransferase, medium-chain/long-chain carnitine acyltransferase, and carnitine medium-chain acyltransferase, is a carnitine acyltransferase belonging to the family of transferases, specifically those acyltransferases transferring groups other than aminoacyl groups that catalyzes the reversible transfer of fatty acyl groups between CoA and carnitine. Carnitine octanoyltransferase (CROT or COT) facilitate the transport of medium- and long-chain fatty acids through the peroxisomal and mitochondrial membranes. It is physiologically inhibited by malonyl-CoA. COT also has functions in efficiently converting one of the end products of the peroxisomal beta-oxidation of pristanic acid, 4, 8-dimethylnonanoyl-CoA, to its corresponding carnitine ester. 

References
  • Ferdinandusse S, et al. (1999) Molecular cloning and expression of human carnitine octanoyltransferase: evidence for its role in the peroxisomal beta-oxidation of branched-chain fatty acids. Biochem Biophys Res Commun. 263 (1): 213-8.
  • Feike R, et al. (2000) Genomics of the Human Carnitine Acyltransferase Genes. Molecular Genetics and Metabolism. 71 (1-2): 139-53.
  • Montserrat Morillas, et al. (2002) Structural Model of a Malonyl-CoA-binding Site of Carnitine Octanoyltransferase and Carnitine Palmitoyltransferase I. The Journal of Biological Chemistry, 277: 11473-80.
  • Size / Price
    Catalog: HG11015-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"