Quick Order

Human SERPINA6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINA6cDNA Clone Product Information
cDNA Size:1218
cDNA Description:ORF Clone of Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6 DNA.
Gene Synonym:CBG,
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human SERPINA6 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Related Products
Product nameProduct name

Corticosteroid-binding globulin (CBG), also known as SerpinA6, is a non-inhibitory member of the serine proteinase inhibitor (serpin) superfamily. It is the high-affinity transport protein for glucocorticoids in vertebrate blood. CBG is specifically cleaved by this protease at a precise site close to its carboxy-terminus. This induces a conformation change and disrupts the binding between glucocorticoids and CBG, and promotes a significant and local release of glucocorticoids (over 90% of them are bound to CBG in human plasma). In this context, CBG directs glucocorticoids to sites of inflammation, and plays in consequence a crucial role in efficient glucocorticoid action in physiology. The SerpinA6 protein is mainly secreted by the liver. This negative acute phase protein regulates free cortisol levels in the blood and distributes cortisol to its target tissues. SerpinA6 deficiency is an extremely rare hereditary disorder characterized by reduced corticosteroid-binding capacity with normal or low plasma corticosteroid-binding globulin concentration, and normal or low basal cortisol levels associated with hypo-/hypertension and muscle fatigue. There are three heritable, human CBG gene mutations that can reduce CBG-cortisol binding affinity and/or reduce circulating CBG levels.

  • Seralini GE. (1991) A new role for corticosteroid binding globulin (CBG), member of SERPIN superfamily. C R Seances Soc Biol Fil. 185(6): 500-9.
  • Buss C, et al. (2007) Haploinsufficiency of the SERPINA6 gene is associated with severe muscle fatigue: A de novo mutation in corticosteroid-binding globulin deficiency. J Neural Transm. 114(5): 563-9.
  • Torpy DJ, et al. (2007) Corticosteroid-binding globulin gene polymorphisms: clinical implications and links to idiopathic chronic fatigue disorders. Clin Endocrinol (Oxf). 67(2): 161-7.
  • Braun BC, et al. (2010) Effect of mutations of the human serpin protein corticosteroid-binding globulin on cortisol-binding, thermal and protease sensitivity. J Steroid Biochem Mol Biol. 120(1): 30-7.
  • Lin HY, et al. (2010) Molecular and structural basis of steroid hormone binding and release from corticosteroid-binding globulin. Mol Cell Endocrinol. 316(1): 3-12.