Quick Order

Cynomolgus monkey IGFBP3 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus IGFBP3 cDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
RefSeq ORF Size:876bp
cDNA Description:Full length Clone DNA of Macaca mulatta insulin-like growth factor binding protein 3 with C terminal His tag.
Gene Synonym:IGFBP3
Species:Cynomolgus
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Background

The Insulin-like Growth Factor (IGF) signaling system plays a central role in cellular growth, differentiation and proliferation. IGFBP3 is the most abundant IGF binding protein in human serum and has been shown to be a growth inhibitory, apoptosis-inducing molecule, capable of acting via IGF-dependent and IGF-independent mechanisms. It appears to function both by cell cycle blockade and the induction of apoptosis. IGFBP3 can be transported to the nucleus by an importin beta mediated mechanism, where it has been shown to interact with the retinoid X receptor alpha and possibly other nuclear elements. IGFBP3 antiproliferative signalling appears to require an active transforming growth factor beta (TGF-beta) signalling pathway, and IGFBP3 stimulates phosphorylation of the TGF-beta signalling intermediates Smad2 and Smad3. IGFBP3 has IGF-independent roles in inhibiting cell proliferation in cancer cell lines. Nuclear transcription factor, retinoid X receptor (RXR)-alpha, and IGFBP3 functionally interact to reduce prostate tumor growth and prostate-specific antigen in vivo. Several clinical studies have proposed that individuals with IGFBP3 levels in the upper range of normal may have a decreased risk for certain common cancers. This includes evidence of a protective effect against breast cancer, prostate cancer, colorectal cancer, and lung cancer. Moreover, IGFBP3 inhibits insulin-stimulated glucose uptake into adipocytes independent of IGF.

References
  • Baxter RC. (2001) Signalling pathways involved in antiproliferative effects of IGFBP-3: a review. Mol Pathol. 54(3): 145-8.
  • Butt AJ, et al. (2001) IGFBP-3 and apoptosis--a license to kill? Apoptosis. 6(3): 199-205.
  • Ali O, et al. (2003) Epidemiology and biology of insulin-like growth factor binding protein-3 (IGFBP-3) as an anti-cancer molecule. Horm Metab Res. 35(11-12): 726-33.
  • Yamada PM, et al. (2009) Perspectives in mammalian IGFBP-3 biology: local vs. systemic action. Am J Physiol Cell Physiol. 296(5): C954-76.
  • Size / Price
    Catalog: CG90084-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"