After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Cynomolgus monkey IGF1R Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IGF1RcDNA Clone Product Information
cDNA Size:4104
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) insulin-like growth factor 1 receptor DNA.
Gene Synonym:IGF1R
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.


The insulin-like growth factor-1 receptor (IGF1R) is a transmembrane tyrosine kinase involved in several biological processes including cell proliferation, differentiation, DNA repair, and cell survival. This a disulfide-linked heterotetrameric transmembrane protein consisting of two α and two β subunits, and among which, the α subunit is extracellular while the β subunit has an extracellular domain, a transmembrane domain and a cytoplasmic tyrosine kinase domain. IGF1R signalling pathway is activated in the mammalian nervous system from early developmental stages. Its major effect on developing neural cells is to promote their growth and survival. This pathway can integrate its action with signalling pathways of growth and morphogenetic factors that induce cell fate specification and selective expansion of specified neural cell subsets. Modulation of cell migration is another possible role that IGF1R activation may play in neurogenesis. In the mature brain, IGF-I binding sites have been found in different regions of the brain, and multiple reports confirmed a strong neuroprotective action of the IGF-IR against different pro-apoptotic insults. IGF1R is an important signaling molecule in cancer cells and plays an essential role in the establishment and maintenance of the transformed phenotype. Inhibition of IGF1R signaling thus appears to be a promising strategy to interfere with the growth and survival of cancer cells. IGF1R is frequently overexpressed by tumours, and mediates proliferation and apoptosis protection. IGF signalling also influences hypoxia signalling, protease secretion, tumour cell motility and adhesion, and thus can affect the propensity for invasion and metastasis. Therefore, the IGF1R is now an attractive anti-cancer treatment target.

  • Bhr C, et al. (2004) The insulin like growth factor-1 receptor (IGF-1R) as a drug target: novel approaches to cancer therapy. Growth Horm IGF Res. 14 (4): 287-95.
  • Riedemann J, et al. (2006) IGF1R signalling and its inhibition. Endocr Relat Cancer. 13 Suppl 1: 33-43.
  • Gualco E, et al. (2009) IGF-IR in neuroprotection and brain tumors. Front Biosci. 14: 352-75.
  • Annenkov A. (2009) The insulin-like growth factor (IGF) receptor type 1 (IGF1R) as an essential component of the signalling network regulating neurogenesis. Mol Neurobiol. 40 (3): 195-215.
  • Size / Price
    List Price: $445.00  (Save $0.00)
    Price:$445.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items