Quick Order

Human A2M Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
A2McDNA Clone Product Information
Gene_bank_ref_id:NM_000014.4
cDNA Size:4425
cDNA Description:ORF Clone of Homo sapiens alpha-2-macroglobulin DNA.
Gene Synonym:CPAMD5, FWP007, S863-7, DKFZp779B086
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

alpha-2-macroglobulin, also known as α2-macroglobulin (α2M and A2M), is an abundant protein of the plasma of vertebrates and members of several invertebrate phyla and functions as a broad-spectrum protease-binding protein. alpha-2-macroglobulin is produced by the liver, and is a major component of the alpha-2 band in protein electrophoresis. alpha-2-macroglobulin is a large plasma glycoprotein that has long been known as an irreversible inhibitor of a variety of proteinases. More recently, it has been reported that numerous growth factors, cytokines and hormones bind to alpha 2M through diverse mechanisms. A2M is also produced in the brain where it binds multiple extracellular ligands and is internalized by neurons and astrocytes. In the brain of Alzheimer's disease (AD) patients, A2M has been localized to diffuse amyloid plaques. A2M also binds soluble beta-amyloid, of which it mediates degradation. Protease-conjugated alpha2-macroglobulin is selectively bound by cells contacting the body fluids and alpha2-macroglobulin and its protease cargo are then internalized and degraded in secondary lysosomes of those cells. In addition to this function as an agent for protease clearance, alpha2-macroglobulin binds a variety of other ligands, including several peptide growth factors and modulates the activity of a lectin-dependent cytolytic pathway in arthropods.

References
  • Kovacs DM. (2000) alpha2-macroglobulin in late-onset Alzheimer's disease. Exp Gerontol. 35(4): 473-9.
  • Armstrong PB, et al. (1999) Alpha2-macroglobulin: an evolutionarily conserved arm of the innate immune system. Dev Comp Immunol. 23(4-5): 375-90.
  • Feige JJ, et al. (1996) Alpha 2-macroglobulin: a binding protein for transforming growth factor-beta and various cytokines. Horm Res. 45(3-5): 227-32.
  • Size / Price
    Catalog:HG10952-CM
    List Price: $445.00  (Save $0.00)
    Price:$445.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"