Quick Order

Text Size:AAA

Ferret CD74 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Ferret CD74 cDNA Clone Product Information
Gene_bank_ref_id:XM_004801653.1
RefSeq ORF Size:648bp
cDNA Description:Full length Clone DNA of Mustela putorius furo (sub-species: furo) CD74 molecule, major histocompatibility complex, class II invariant chain with N terminal Myc tag.
Gene Synonym:CD74
Species:Ferret
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD74, also known as HLA class2 histocompatibility antigen gamma chain and HLA-DR antigens-associated invariant chain, is a polypeptide involved in the formation and transport of MHC class2 protein. CD74 is expressed by B cells, macrophages, and Reed-Sternberg cells. When MHC class 2 protein was in the rough ER, its peptide-binding cleft was blocked by CD74 to prevent it from interacting with the endogenous peptides. CD74 also serves to facilitate MHC class2's export from ER.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Moynes R, et al. (1997) A marker to distinguish atypical fibroxanthoma from malignant fibrous histiocytoma. Cancer. 79 (11): 2115-24.
  • Gabrielle FA, et al. (2008) Regulation of dendritic cell migration by CD74, the MHC class 2-associated invariant chain. Science. 322 (5908): 1705-10.
  • Leng L, et al. (2003) MIF signal transduction initiated by binding to CD74. JEM.197 (11): 1467-76.
  • Size / Price
    Catalog: FG60049-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"