After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Ferret TREM1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TREM1cDNA Clone Product Information
cDNA Size:615
cDNA Description:ORF Clone of Mustela putorius furo (sub-species: furo) triggering receptor expressed on myeloid cells 1 DNA.
Gene Synonym:TREM1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

TREM1 (triggering receptor expressed on myeloid cells) is a type I  transmembrane protein with a single Ig-like domain, and is selectively expressed on blood neutrophils and a subset of monocytes. As a member of the growing family of receptors related to NK cell receptors, TREM1 activates downstream signaling events with the help of an adapter protein called DAP12. Expression of TREM1 is up-regulated by bacterial LPS, a ligand for TLR4, as well as lipoteichoic acid. Although its natural ligand has not been identified, engagement of TREM1 with agonist mAbs triggers secretion of the proinflammatory cytokines TNF-α and IL-1β, as well as chemokines such as IL-8 and monocyte chemoattractant protein (MCP)-1. Intracellularly, TREM1 induces Ca2+ mobilization and tyrosine phosphorylation of extracellular signal-related kinase 1 (ERK1), ERK2 and phospholipase C-γ. In an animal model of LPS-induced septic shock, blockade of TREM1 signaling inhibited hyperresponsiveness and death. Thus, it has been demonstrated that TREM1 performs a critical function in immune responses involved in host defense against microbial challenges, and is suggested to be a potential therapeutic target for septic shock.

  • Bouchon, A. et al., 2000, J. Immunol. 164: 4991-4995.
  • Bouchon, A. et al., 2001, Nature. 410: 1103-1107.
  • Bleharski, J.R. et al., 2003, J. Immunol. 170: 3812-3818.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items