Quick Order

Cynomolgus monkey TGFB2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TGFB2cDNA Clone Product Information
cDNA Size:1245
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) transforming growth factor, beta 2 DNA.
Gene Synonym:Img, LIG-1, D6Bwg0781e, Lrig1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Transforming Growth Factor Beta (TGF-beta) Family Related Products
Product nameProduct name
Rat Cripto / TDGF1 Protein (His Tag)Rat Latent TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGF-beta 1 / TGFB1 Protein (His Tag)Canine TGFB2 / TGF-beta 2 Protein (His Tag)Mouse TGF-beta 2 / TGFB2 Protein (His Tag)Mouse ALK-4 / ACVR1B Protein (Fc Tag)Human ALK-7 / ACVR1C Protein (ECD, Fc Tag)Mouse Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human Endoglin / CD105 / ENG Protein (Fc Tag)Human Endoglin / CD105 / ENG Protein (His Tag)Human Decorin / DCN / SLRR1B Protein (Fc Tag)Human Decorin / DCN / SLRR1B Protein (His Tag)Human ALK-2 / ACVR1 Protein (His & Fc Tag)Human ALK-2 / ACVR1 / ALK2 Protein (His Tag)Human TGFBR2 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (His & Fc Tag)Human TGFBR1 / ALK-5 / SKR4 Protein (aa 200-503, His & GST Tag)Human ALK4 / ACVR1B Protein (His & Fc Tag)Human ALK4 / ACVR1B Protein (His Tag)Mouse BAMBI / NMA Protein (His Tag)Rat / Mouse TGF-beta 1 / TGFB1 ProteinHuman TGFBR3 / Betaglycan Protein (His Tag)Human Latent TGF-beta 1 / TGFB1 Protein (His Tag)Human / Rhesus / Canine TGF-beta 1 / TGFB1 ProteinHuman BAMBI / NMA Protein (His Tag)Human Cripto / TDGF1 Protein (His Tag)Human ATF2 Protein (His & GST Tag)Mouse ALK-2 / ACVR1 Protein (His & Fc Tag)Mouse Endoglin / CD105 / ENG Protein (His Tag)Mouse TGFBR3 / Betaglycan Protein (His Tag)Mouse Smad2 Protein (His & GST Tag)Mouse Smad5 Protein (His & GST Tag)Mouse Smad5 ProteinMouse BAMBI / NMA Protein (Fc Tag)Mouse Smad3 Protein (His & GST Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Canine ALK-2 / ACVR1 / ALK2 Protein (His Tag)Rat ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Rat Cripto / TDGF1 Protein (Fc Tag)Rat ACVR1B / ALK-4 Protein (Fc Tag)Rat TGFBR2 Protein (Fc Tag)Cynomolgus ALK-2 / ACVR1 / ALK2 Protein (Fc Tag)Cynomolgus TGFBR2 Protein (Fc Tag)Cynomolgus ACVR1B / ALK-4 Protein (Fc Tag)Cynomolgus ALK-7 / ALK7 / ACVR1C Protein (Fc Tag)Cynomolgus TGF-beta 1 / TGFB1 Protein (His Tag)

TGF beta 2 (Transforming growth factor beta 2), an extracellular glycosylated protein, which belongs to the TGF-beta family. TGF-beta regulates key mechanisms of tumor development, namely immunosuppression, metastasis, angiogenesis, and proliferation. TGF beta 2 suppression is a promising therapeutic approach for malignant tumor therapy. The signaling pathway of TGF beta 2/Smad plays an important role in the pathological process in posterior capsule opacification (PCO) after cataract surgery. Silencing Smad2 and Smad3 efficiently blocked the effect of TGF beta 2 on cell proliferation, migration, and extracellular matrix production. TGF beta 2 activation of MEKK3/ERK1/2/5 signaling modulates Has2 expression and hyaluronan (HA) production leading to the induction of epithelial to mesenchymal transformation (EMT) events. In addition, the upregulation of the TGF beta 2 level is a common pathological feature of Alzheimer's disease (AD) brains and suggests that it may be closely linked to the development of neuronal death related to AD.

  • Schlingensiepen KH, et al. (2006) Targeted tumor therapy with the TGF-beta 2 antisense compound AP 12009. Cytokine Growth Factor Rev. 17(1-2): 129-39.
  • Ghatpande SK, et al. (2010) Transforming growth factor beta2 is negatively regulated by endogenous retinoic acid during early heart morphogenesis. Dev Growth Differ. 52(5): 433-55.
  • Noguchi A, et al. (2010) Transforming growth factor beta2 level is elevated in neurons of Alzheimer's disease brains. Int J Neurosci. 120(3): 168-75.
  • Li J, et al. (2011) Comparative effects of TGF-_2/Smad2 and TGF-_2/Smad3 signaling pathways on proliferation, migration, and extracellular matrix production in a human lens cell line. Exp Eye Res. 92(3): 173-9.