After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Cynomolgus monkey CSF1R Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CSF1RcDNA Clone Product Information
Gene_bank_ref_id:unsubmitted
cDNA Size:2931
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) colony stimulating factor 1 receptor DNA.
Gene Synonym:CSF1R
Species:Cynomolgus
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Colony-Stimulating Factor (CSF) & Receptor Related Products
Background

M-CSFR encoded by the proto-oncogene c-fms is the receptor for colony stimulating factor 1 (CSF1R), a cytokine involved in the proliferation, differentiation, and activation of macrophages. This cell surface glycoprotein is consisted by an extracellular ligand-binding domain, a single membrane-spanning segment, and an intracellular tyrosine kinase domain. Binding of CSF1 activates the receptor kinase, leading to "autophosphorylation" of receptor subunits and the concomitant phosphorylation of a series of cellular proteins on tyrosine residues. CSF1R is a tyrosine kinase receptor that is absolutely required for macrophage differentiation and thus occupies a central role in hematopoiesis. CSF1 and its receptor (CSF1R, product of c-fms proto-oncogene) were initially implicated as essential for normal monocyte development as well as for trophoblastic implantation. This apparent role for CSF1/CSF1R in normal mammary gland development is very intriguing because this receptor/ligand pair has also been found to be important in the biology of breast cancer in which abnormal expression of CSF1 and its receptor correlates with tumor cell invasiveness and adverse clinical prognosis. Tumor cell expression of CSF1R is under the control of several steroid hormones (glucocorticoids and progestins) and the binding of several bHLH transcription factors, while tumor cell expression of CSF-1 appears to be regulated by other hormones, some of which are involved in normal lactogenic differentiation. However, studies have demonstrated that CSF1 and CSF1R have additional roles in mammary gland development during pregnancy and lactation. The role of CSF1 and CSF1R in normal and neoplastic mammary development that may elucidate potential relationships of growth factor-induced biological changes in the breast during pregnancy and tumor progression.

References
  • Sherr CJ. (1990) The colony-stimulating factor 1 receptor: pleiotropy of signal-response coupling. Lymphokine Res. 9(4): 543-8.
  • Kacinski BM. (1997) CSF-1 and its receptor in breast carcinomas and neoplasms of the female reproductive tract. Mol Reprod Dev. 46(1): 71-4.
  • Sapi E, et al. (1999) The role of CSF-1 in normal and neoplastic breast physiology. Proc Soc Exp Biol Med. 220(1): 1-8.
  • Sapi E. (2004) The role of CSF-1 in normal physiology of mammary gland and breast cancer: an update. Exp Biol Med (Maywood). 229(1): 1-11.
  • Bonifer C, et al. (2008) The transcriptional regulation of the Colony-Stimulating Factor 1 Receptor (csf1r) gene during hematopoiesis. Front Biosci. 13: 549-60.
  • Size / Price
    Catalog:CG90035-CH
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"