Quick Order

Text Size:AAA

Human C1QB Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
C1QBcDNA Clone Product Information
cDNA Size:762
cDNA Description:ORF Clone of Homo sapiens complement component 1, q subcomponent, B chain DNA.
Gene Synonym:C1QB
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Complement Component 1, q subcomponent (C1q) associates with C1r and C1s in order to yield the first component of the serum complement system. Deficiency of C1q has been associated with lupus erythematosus and glomerulonephritis. C1q is composed of 18 polypeptide chains: six A-chains, six B-chains, and six C-chains. Southern blot analysis of chromosomal DNA from vertebrate species demonstrated highest similarity between the C1qB genes, followed by C1qC and finally C1qA. Sequence comparison of C1q from three different species have shown that the B chains have the strongest similarity. C1q was already present at embryonic day 14 (E14) and showed little change in abundance through six weeks postnatal. At E16, C1qB mRNA was present at high abundance in putative microglia/macrophages in cortical marginal and intermediate zones, and hippocampal analge.

  • Pasinetti GM, et al. (1992) Complement C1qB and C4 mRNAs responses to lesioning in rat brain. Experimental neurology. 118(2): 117-25.
  • Johnson SA, et al. (1994) Expression of complement C1qB and C4 mRNAs during rat brain development. Brain Res Dev Brain Res. 80(1-2): 163-74.
  • Grewal RP,et al. (1999) C1qB and clusterin mRNA increase in association with neurodegeneration in sporadic amyotrophic lateral sclerosis. Neuroscience letters. 271(1): 65-7.
  • Spielman L, et al. (2002) Induction of the complement component C1qB in brain of transgenic mice with neuronal overexpression of human cyclooxygenase-2. Acta neuropathologica. 103(2): 157-62.