After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Ferret CD8a / CD8 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Ferret CD8A cDNA Clone Product Information
NCBI RefSeq:EF492056.1
RefSeq ORF Size:739bp
cDNA Description:Full length Clone DNA of Ferret CD8 antigen with N terminal Myc tag.
Gene Synonym:CD8
Species:Ferret
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Human T-cell surface glycoprotein CD8 alpha chain, also known as CD8a, is a single-pass type I  membrane protein. The CD8 glycoprotein is expressed by thymocytes, mature T cells and natural killer (NK) cells and has been implicated in the recognition of monomorphic determinants on major histocompatibility complex (MHC) Class I antigens, and in signal transduction during the course of T-cell activation. Both human and rodent CD8 antigens are comprised of two distinct polypeptide chains, alpha and beta. The Ig domains of CD8 alpha are involved in controlling the ability of CD8 to be expressed. Mutation of B- and F-strand cysteine residues in CD8 alpha reduced the ability of the protein to fold properly and, therefore, to be expressed. Defects in CD8A are a cause of familial CD8 deficiency. Familial CD8 deficiency is a novel autosomal recessive immunologic defect characterized by absence of CD8+ cells, leading to recurrent bacterial infections.

References
References Devine, L. et al., 2000, J Immunol. 164 (2): 833-8. Arcaro, A. et al., 2000, J Immunol. 165 (4): 2068-76. Saha, K. et al., 2001, Nat Med. 7 (1): 65-72. Romero, P. et al., 2005, Eur J Immunol. 35 (11): 3092-4.
Size / Price
Catalog: FG60001-NM
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"