After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Cynomolgus monkey CXCL13 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CXCL13cDNA Clone Product Information
cDNA Size:330
cDNA Description:ORF Clone of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) chemokine (C-X-C motif) ligand 13 DNA.
Gene Synonym:CXCL13, BLC
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Chemokine & Receptor Related Products
Product nameProduct name

The chemokine CXCL13, also known as BCA-1 (B-cell-attracting chemokine-1) or BLC (B-lymphocyte chemoattractant), which belongs to the CXC chemokine family. CXCL13 and its receptor CXCR5 control the organization of B cells within follicles of lymphoid tissues. CXCL13 is known to dictate homing and motility of B cells in lymphoid tissue and has been implicated in the formation of ectopic lymphoid tissue in chronic inflammation. It involves in B-cell compartmental homing within secondary lymphoid organs and recently implicated in the pathogenesis of inflammatory and malignant lymphocyte-mediated diseases. In Primary central nervous system lymphoma (PCNSL), expression of BCA-1 by malignant lymphocytes and vascular endothelium may influence tumor development and localization to central nervous system (CNS). In T-lymphocytes, CXCL13 expression is thought to reflect a germinal center origin of the T-cell. CXCL13 expression may also provide an additional useful tool for the diagnosis of Angioimmunoblastic T-cell lymphoma (AITL).

  • Ansel KM, et al. (2000) A chemokine-driven positive feedback loop organizes lymphoid follicles. Nature. 406 (6793): 309-14.
  • Smith JR, et al. (2003) Expression of B-cell-attracting chemokine 1 (CXCL13) by malignant lymphocytes and vascular endothelium in primary central nervous system lymphoma. Blood. 101(3): 815-21.
  • Dupuis J, et al. (2006) Expression of CXCL13 by neoplastic cells in angioimmunoblastic T-cell lymphoma (AITL): a new diagnostic marker providing evidence that AITL derives from follicular helper T cells. Am J Surg Pathol. 30(4): 490-4.
  • de Leval L, et al. (2007) The gene expression profile of nodal peripheral T-cell lymphoma demonstrates a molecular link between angioimmunoblastic T-cell lymphoma (AITL) and follicular helper T (TFH) cells. Blood. 109 (11): 4952-63.
  • Schiffer L, et al. (2009) B-cell-attracting chemokine CXCL13 as a marker of disease activity and renal involvement in systemic lupus erythematosus (SLE). Nephrol Dial Transplant. 24(12): 3708-12.
  • Rupprecht TA, et al. (2009) The chemokine CXCL13 is a key regulator of B cell recruitment to the cerebrospinal fluid in acute Lyme neuroborreliosis. J Neuroinflammation. 6: 42.