After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

E.Coli FABI ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
E. coli FABI cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:789bp
cDNA Description:Full length Clone DNA of Escherichia coli enoyl-[acyl-carrier-protein] reductase, NADH-dependent with N terminal Myc tag.
Gene Synonym:envM
Species:E. coli
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Enoyl-ACP reductase, also known as NADH-dependent enoyl-ACP reductase and FABI, is a cell inner membrane and peripheral membrane protein which belongs to the short-chain dehydrogenases/reductases (SDR) family and FabI subfamily. Microorganisms produce many kinds of antibiotics which function in an antagonistic capacity in nature where they have much competition. Bacterial FAS provides essential fatty acids for use in the assembly of key cellular components. Among them, FABI is an enoyl-ACP reductase which catalyzes the final and rate-limiting step of bacterial FAS. The antibiotic diazaborine interferes with the activity by binding to the protein. FABI is a potential target for selective antibacterial action, because it shows low overall sequence homology with mammalian enzymes. Various compounds have been reported as inhibitors of bacterial FabI-inhibitory compounds.

References
  • Miller, WH. et al., 2002, J Med Chem  45 (15):3246-56. 
  • Kitagawa, H. et al., 2007, Bioorg Med Chem  15 (2):1106-16.
  • Zheng, C.J. et al., 2007, Biochem Biophys Res Commun 362 (4):1107-12.
  • Lu,H. et al., 2008, Acc Chem Res 41 (1):11-20.
  • Zheng,CJ. et al., 2009, J Antimicrob Chemother 63 (5):949-53.
  • Size / Price
    Catalog: EG30001-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"