After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Canine SPARCL1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Canine SPARCL1 cDNA Clone Product Information
Gene_bank_ref_id:XM_005639162.1
RefSeq ORF Size:2004bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris SPARC-like 1 (hevin) with N terminal Myc tag.
Gene Synonym:SPARCL1
Species:Canine
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

SPARC-like protein 1 (SPARCL1; also known as SC1, high endothelial venule protein, or hevin) is an extracellular matrix-associated, secreted glycoprotein belonging to the secreted protein acidic and rich in cysteine (SPARC) family of matricellular proteins. It contains three conserved structural domains that are implicated in the regulation of cell adhesion, migration, and proliferation. SPARCL1 is expressed during embryogenesis and tissue remodeling and is especially prominent in brain and vasculature. Its down-regulation in a number of cancers and the possibility of its functional compensation by SPARC has led to recent interest in hevin as a tumor suppressor and regulator of angiogenesis. SPARCL1 has antiadhesive properties, and loss of SPARCL1 expression is associated with increased proliferative activity and cell cycle progression. It is suggested that it may influence multiple cellular processes during distinct stages of brain development and function. In addition, SPARCL1 can influence the function of astroglial cells in the developing and mature central nervous system (CNS).

References
  • Sullivan MM, et al. (2004) Hevin/SC1, a matricellular glycoprotein and potential tumor-suppressor of the SPARC/BM-40/Osteonectin family. Int J Biochem Cell Biol. 36(6): 991-6.
  • Esposito I, et al. (2007) Tumor-suppressor function of SPARC-like protein 1/Hevin in pancreatic cancer. Neoplasia. 9(1): 8-17.
  • Weimer JM, et al. (2008) A BAC transgenic mouse model to analyze the function of astroglial SPARCL1 (SC1) in the central nervous system. Glia. 56(9): 935-41.
  • Size / Price
    Catalog: DG70239-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"