After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rhesus FCGR3 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Cynomolgus FCGR3 cDNA Clone Product Information
NCBI RefSeq:EF396938.1
RefSeq ORF Size:765bp
cDNA Description:Full length Clone DNA of Macaca mulatta (Rhesus monkey) Fc gamma RIIIa with C terminal His tag.
Gene Synonym:FCGR3, FcRIII
Species:Rhesus
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Fc receptors bind the most common class of antibody, IgG, are called Fc gamma receptors (FcγR). FcγR is divided into three classes, Fc γ RI (CD64), Fc γ RII (CD32), and Fc γ RIII (CD16). CD16 protein is a multifunctional, low/intermediate affinity receptor, which belongs to the immunoglobulin superfamily. It is found on the surface of natural killer cells, neutrophil polymorphonuclear leukocytes, monocytes and macrophages. Mouse CD16 is encoded by a single gene, while, human CD16 is expressed as two distinct forms (CD16a/FcγRIIIa and CD16b/FcγRIIIb) encoded by two different highly homologous genes in a cell type-specific manner. CD16 is involved in phagocytosis, secretion of enzymes, inflammatory mediators, antibody-dependent cellular cytotoxicity (ADCC), and clearance of immune complexes.

References
  • Edberg JC, et al. (2002) Genetic linkage and association of Fcgamma receptor IIIA (CD16A) on chromosome 1q23 with human systemic lupus erythematosus. Arthritis Rheum. 46(8): 2132-40.
  • Li P, et al. (2002) Recombinant CD16A-Ig forms a homodimer and cross-blocks the ligand binding functions of neutrophil and monocyte Fcgamma receptors. Mol Immunol. 38(7): 527-38.
  • Li P, et al. (2007) Affinity and kinetic analysis of Fcgamma receptor IIIa (CD16a) binding to IgG ligands. J Biol Chem. 282(9): 6210-21.
  • Size / Price
    Catalog: CG90013-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"