Quick Order

Text Size:AAA

Human TIGIT / VSTM3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TIGITcDNA Clone Product Information
Gene_bank_ref_id:NM_173799.2
cDNA Size:735
cDNA Description:ORF Clone of Homo sapiens T cell immunoreceptor with Ig and ITIM domains DNA.
Gene Synonym:VSIG9, VSTM3, FLJ39873, DKFZp667A205
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

TIGIT, also known as V-set and transmembrane domain-containing protein 3 (VSTM3) or V-set and immunoglobulin domain-containing protein 9 (VSIG9) is a new surface protein containing an immunoglobulin variable domain, a transmembrane domain and an immunoreceptor tyrosine-based inhibitory motif (ITIM). TIGIT is expressed on regulatory, memory, activated T cells and NK cells. It binds PVR with high affinity, and PVRL2 with lower affinity, but not PVRL3. Knockdown of TIGIT with siRNA in human memory T cells did not affect T cell responses, however, TIGIT inhibits NK cytotoxicity directly through its ITIM. TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells. The binding of PVR to TIGIT on human dendritic cells enhanced the production of IL-10 and diminished the production of IL-12p40. In addition, TIGIT counter inhibits the NK-mediated killing of tumor cells and protects normal cells from NK-mediated cytotoxicity thus providing an "alternative self" mechanism for MHC class I inhibition.

Size / Price
Catalog:HG10917-CM
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
Images
    Recently Viewed Items
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"