Quick Order

Canine CLU Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLUcDNA Clone Product Information
cDNA Size:1338
cDNA Description:ORF Clone of Canis lupus familiaris clusterin DNA.
Gene Synonym:GP80
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Clusterin, also known as complement-associated protein SP-40, Complement cytolysis inhibitor, Apolipoprotein J, Testosterone-repressed prostate message 2, Aging-associated gene 4 protein, CLU and APOJ, is a secreted protein which belongs to the clusterin family. Clusterin/Apolipoprotein J/Apo-J is an enigmatic glycoprotein with a nearly ubiquitous tissue distribution and an apparent involvement in biological processes ranging from mammary gland involution to neurodegeneration in Alzheimer's disease. Its major form, a heterodimer, is secreted and present in physiological fluids, but truncated forms targeted to the nucleus have also been identified. Clusterin/Apolipoprotein J/Apo-J is a widely distributed glycoprotein with a wide range of biologic properties. A prominent and defining feature of clusterin is its marked induction in such disease states as glomerulonephritis, cystic renal disease, renal tubular injury, neurodegenerative conditions, atherosclerosis, and myocardial infarction. Upregulation of clusterin mRNA and protein levels detected in diverse disease states and in in vitro systems have led to suggestions that it functions in membrane lipid recycling, in apoptotic cell death, and as a stress-induced secreted chaperone protein, amongst others.

  • Silkensen JR, et al. (1994) The role of clusterin in tissue injury. Biochem Cell Biol. 72(11-12): 483-8.
  • Naik RR, et al. (2002) Biomimetic synthesis and patterning of silver nanoparticles. Nat Mater. 1(3): 169-72.
  • Djeu JY, et al. (2009) Clusterin and chemoresistance. Adv Cancer Res. 105: 77-92.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items