Quick Order

Text Size:AAA

Canine GABARAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GABARAPL2cDNA Clone Product Information
Gene_bank_ref_id:XM_005620674.1
cDNA Size:354
cDNA Description:ORF Clone of Canis lupus familiaris GABA(A) receptor-associated protein-like 2 DNA.
Gene Synonym:GABARAPL2
Species:Canine
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Canine GABARAPL2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name
Background

GATE-16, also known as ATG8, belongs to the MAP1 LC3 family. It is expressed at high levels in the brain, heart, prostate, ovary, spleen and skeletal muscle. GATE-16 is expressed at very low levels in lung, thymus and small intestine. GATE-16 is involved in intra-Golgi traffic. It modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1.

References
  • Ewing Rob M, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Okazaki N, et al. (2000) Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation. Brain Res Mol Brain Res. 85(1-2):1-12.
  • Xin Y, et al. (2001) Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein. Genomics. 74 (3):408-13.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"