After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CXCL4 / PF4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PF4cDNA Clone Product Information
cDNA Size:306
cDNA Description:ORF Clone of Homo sapiens platelet factor 4 DNA.
Gene Synonym:CXCL4, SCYB4, MGC138298, PF4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CXCL4 / PF4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Chemokine & Receptor Related Products
Product nameProduct name

Platelet factor 4 (PF4), also known as chemokine (C-X-C motif) ligand 4 (CXCL4), is a small cytokine belonging to the CXC chemokine family. CXCL4/PF4 is released from the alpha-granules of activated platelets and binds with high affinity to heparin. Its major physiologic role appears to be neutralization of heparin-like molecules on the endothelial surface of blood vessels, thereby inhibiting local antithrombin III activity and promoting coagulation. As a strong chemoattractant for neutrophils and fibroblasts, CXCL4/PF4 probably has a role in inflammation and wound repair. This protein is released during platelet aggregation. CXCL4/PF4 neutralizes the anticoagulant effect of heparin because it binds more strongly to heparin than to the chondroitin-4-sulfate chains of the carrier molecule. CXCL4 is chemotactic for neutrophils and monocytes. It inhibits endothelial cell proliferation, the short form is a more potent inhibitor than the longer form. CXCL4/PF4 is up-regulated in human liver fibrosis and that it plays a nonredundant, functional role in experimental liver fibrosis by mediating stellate cell proliferation, migration, and intrahepatic immune cell recruitment.

  • Zaldivar MM, et al. (2010) CXC chemokine ligand 4 (Cxcl4) is a platelet-derived mediator of experimental liver fibrosis. Hepatology. 51(4): 1345-53.
  • Lasagni L, et al. (2007) PF-4/CXCL4 and CXCL4L1 exhibit distinct subcellular localization and a differentially regulated mechanism of secretion. Blood. 109(10): 4127-34.
  • Struyf S, et al. (2004) Platelets release CXCL4L1, a nonallelic variant of the chemokine platelet factor-4/CXCL4 and potent inhibitor of angiogenesis. Circ Res. 95(9): 855-7.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items