After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Canine GM2A ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Canine GM2A cDNA Clone Product Information
Gene_bank_ref_id:XM_003639011.2
RefSeq ORF Size:591bp
cDNA Description:Full length Clone DNA of Canis lupus familiaris GM2 ganglioside activator with N terminal Myc tag.
Gene Synonym:GM2A
Species:Canine
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

GM2A (GM2 ganglioside activator), is a lipid transfer protein which belongs to the ML domain family. GM2A can accommodate several single chain phospholipids and fatty acids. It also exhibits some calcium-independent phospholipase activity. GM2A binds gangliosides and stimulates ganglioside GM2 degradation. It stimulates only the breakdown of ganglioside GM2 and glycolipid GA2 by beta-hexosaminidase A. GM2A acts as a substrate specific co-factor for the lysosomal enzyme β-hexosaminidase A. β-hexosaminidase A, together with GM2 ganglioside activator, catalyzes the degradation of the ganglioside GM2, and other molecules containing terminal N-acetyl hexosamines. It extracts single GM2 molecules from membranes and presents them in soluble form to beta-hexosaminidase A for cleavage of N-acetyl-D-galactosamine and conversion to GM3. Defects in GM2A are the cause of GM2-gangliosidosis type AB (GM2GAB), also known as Tay-Sachs disease AB variant.

References
  • Wright CS, et al. (2003) Structural analysis of lipid complexes of GM2-activator protein. J Mol Biol. 331(4):951-64.
  • Size / Price
    Catalog: DG70177-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"