Quick Order

Human PLA2G1B Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PLA2G1BcDNA Clone Product Information
Gene_bank_ref_id:NM_000928.2
cDNA Size:447
cDNA Description:ORF Clone of Homo sapiens phospholipase A2, group IB (pancreas) DNA.
Gene Synonym:RLF, RLNL, MGC119818, MGC119819, INSL3
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Mouse phospholipase A2, also known as Phosphatidylcholine 2-acylhydrolase 1B, Group IB phospholipase A2, PLA2 and PLA2G1B, is a secreted protein which belongs to the phospholipase A2 family. Phospholipase A2 / PLA2G1B catalyzes the release of fatty acids from glycero-3-phosphocholines. The best known varieties are the digestive enzymes secreted as zymogens by the pancreas of mammals. Sequences of pancreatic Phospholipase A2 / PLA2G1B enzymes from a variety of mammals have been reported. One striking feature of these enzymes is their close homology to venom phospholipases of snakes. Other forms of Phospholipase A2 / PLA2G1B have been isolated from brain, liver, lung, spleen, intestine, macrophages, leukocytes, erythrocytes, inflammatory exudates, chondrocytes, and platelets. Mice lacking in Phospholipase A2 / PLA2G1B are resistant to obesity and diabetes induced by feeding a diabetogenic high-fat/high-carbohydrate diet. Oral supplementation of a diabetogenic diet with the PLA2G1B inhibitor methyl indoxam effectively suppresses diet-induced obesity and diabetes. PLA2G1B inhibition may be a potentially effective oral therapeutic option for treatment of obesity and diabetes.

References
  • Labonté,E.D. et al., 2006, Diabetes. 55 (4) :935-41.
  • Mounier,C.M. et al.,2008, Br J Cancer. 98 (3):587-95.
  • Hui,D.Y. et al., 2009, Br J Pharmacol. 157 (7):1263-9.
  • Labonté,E.D. et al., 2010, FASEB J. 24 (7):2516-24.
  • Size / Price
    Catalog:HG10865-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"