Quick Order

Text Size:AAA

Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
HDAC8cDNA Clone Product Information
Gene_bank_ref_id:NM_018486.1
cDNA Size:1134
cDNA Description:ORF Clone of Homo sapiens histone deacetylase 8 DNA.
Gene Synonym:RPD3, HDACL1
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10864-ACG$325
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10864-ACR$325
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10864-ANG$325
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10864-ANR$325
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10864-CF$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10864-CH$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10864-CM$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10864-CY$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone)HG10864-M$95
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10864-M-F$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10864-M-N$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10864-NF$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10864-NH$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10864-NM$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10864-NY$295
Human HDAC8 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10864-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name
Background

Histone deacetylase 8, also known as HDAC8 and HDACL1, is a nucleus and cytoplasm protein which belongs to the histone deacetylase family and HD type 1 subfamily. Histone deacetylases (HDACs) are a growing family of enzymes implicated in transcriptional regulation by affecting the acetylation state of core histones in the nucleus of cells. HDAC8 / HDACL1 is weakly expressed in most tissues. It expressed at higher level in heart, brain, kidney and pancreas and also in liver, lung, placenta, prostate and kidney. HDAC8 / HDACL1 is responsible for the deacetylation of lysine residues on the N-terminal part of the core histones ( H2A, H2B, H3 and H4 ). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. HDAC8 / HDACL1 may play a role in smooth muscle cell contractility. HDAC8 / HDACL1 may be a potential drug target for neuroblastoma differentiation therapy using selective inhibitors, avoiding unspecific side effects.

References
  • Buggy JJ. et al.,2000, Biochem J. 350 (1): 199-205.
  • Krennhrubec K. et al., 2007, Bioorg Med Chem Lett. 17 (10): 2874-8.
  • Oehme I. et al., 2009, Expert Opin Investig Drugs.18 (11): 1605-17.
  • Size / Price
    Catalog:HG10864-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"