After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human PLA2G7 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PLA2G7cDNA Clone Product Information
cDNA Size:1371
cDNA Description:ORF Clone of Homo sapiens phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) DNA.
Gene Synonym:PAFAH, LDL-PLA2
Restriction Site:KpnI + XbaI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Platelet-activating factor acetylhydrolase, also known as 1-alkyl-2-acetylglycerophosphocholine esterase, 2-acetyl-1-alkylglycero-phosphocholine esterase, Group-VIIA phospholipase A2, LDL-associated phospholipase A2, PAF 2-acylhydrolase, PLA2G7 and PAFAH, is secreted protein which belongs to the AB hydrolase superfamily and Lipase family. PLA2G7 / PAFAH modulates the action of platelet-activating factor (PAF) by hydrolyzing the sn-2 ester bond to yield the biologically inactive lyso-PAF. It has a specificity for substrates with a short residue at the sn-2 position. It is inactive against long-chain phospholipids. PLA2G7 / PAFAH is a potent pro- and anti-inflammatory molecule that has been implicated in multiple inflammatory disease processes, including cardiovascular disease. PLA2G7 also represents an important, potentially functional candidate in the pathophysiology of coronary artery disease (CAD). Defects in PLA2G7 are the cause of platelet-activating factor acetylhydrolase deficiency (PLA2G7 deficiency). It is a trait which is present in 27% of Japanese. It could have a significant physiologic effect in the presence of inflammatory bodily responses.

  • Stafforini D.M., et al., 1996, J. Clin. Invest. 97:2784-2791.
  • Yoshida H., et al., 1998, Thromb. Haemost. 80:372-375.
  • Yamada Y., et al., 1998, Metabolism 47:177-181.
  • Kruse S., et al., 2000, Am. J. Hum. Genet. 66:1522-1530. 
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 Business days
    • Human PLA2G7 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged
    Recently Viewed Items