After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human Soggy-1 ORF mammalian expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human DKKL1 cDNA Clone Product Information
NCBI RefSeq:NM_014419.3
RefSeq ORF Size:729bp
cDNA Description:Full length Clone DNA of Homo sapiens dickkopf-like 1 (soggy) with C terminal Myc tag.
Gene Synonym:SGY, SGY1, SGY-1, DKKL1
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Dickkopf-like 1 (DKKL1) or soggy 1, is a glycoprotein unique to mammals that is expressed primarily in developing spermatocytes and localized in the acrosome of mature sperm. It is also expressed in the trophectoderm / placental lineage. This glycoprotein is secreted by postmeiotic male germ cells. DKKL1 is a member of the Dickkopf (DKK) family, a group of proteins that are characterized as secreted antagonists of Wnt signal transduction proteins. In mammals, embryos lacking DKKL1 protein developed into viable, fertile adults. DKKL1, either directly or indirectly, facilitates the ability of sperm to penetrate the zona pellucid. DKKL1 is related to the sperm apoptotic procession. Molecular analyses identified the Fas death ligand (FasL) as a target for DkkL1 pro-apoptotic activity in adult mice. DKKL1 is considered as a negative regulator of adult testic homeostasis and identifies a novel, DKKL1 / FasL- dependent, regulation that specifically controls the number of postpubertal spermatocytes. 

References
  • Niehrs C. (2006) Function and biological roles of the Dickkopf family of Wnt modulators. Oncogene. 25 (57): 7469-81.
  • Kohn MJ, et al. (2010) The Acrosomal Protein Dickkopf-Like 1 (DKKL1) Facilitates Sperm Penetration Of The Zona Pellucida. Fertil Steril. 93 (5): 1533-7.
  • KOHN MJ, et al. (2005) DKKL1 (Soggy), A Dickkopf Family Member, Localizes to the Acrosome During Mammalian Spermatogenesis. Mol Reprod Dev. 71 (4): 516-22.
  • Size / Price
    Catalog: HG10840-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"