Quick Order

Human GRK5 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GRK5cDNA Clone Product Information
Gene_bank_ref_id:NM_005308.2
cDNA Size:1773
cDNA Description:ORF Clone of Homo sapiens G protein-coupled receptor kinase 5 DNA.
Gene Synonym:GPRK5, GRK5
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

G protein-coupled receptor kinase 5, also known as G protein-coupled receptor kinase GRK5 and GRK5, is a member of the protein kinase superfamily, AGC Ser/Thr protein kinase family and GPRK subfamily. GRKs specifically phosphorylate agonist-occupied G protein-coupled receptors at the inner surface of the plasma membrane (PM), leading to receptor desensitization. GRKs utilize a variety of mechanisms to bind tightly, and sometimes reversibly, to cellular membranes. GRKs play an important role in mediating agonist-specific desensitization of numerous G protein-coupled receptors.
GRK5 contains one AGC-kinase C-terminal domain, one protein kinase domain and one RGS domain. GRK5 specifically phosphorylates the activated forms of G protein-coupled receptors. Phospholipid-stimulated autophosphorylation may represent a novel mechanism for membrane association and regulation of GRK5 activity. GRK5 deficiency significantly exaggerates microgliosis and astrogliosis in the presence of an inflammatory initiator, such as the excess fibrillar Abeta and the subsequent active inflammatory reactions. GRK5 deficiency has been linked to early Alzheimer's disease in humans and mouse models of the disease.

References
  • Kunapuli,P. et al., 1994, J Biol Chem. 269 (14):10209-12.
  • Millman,E.E. et al., 2004, Br J Pharmacol  141 (2):277-84.
  • Thiyagarajan,M.M. et al., 2004, J Biol Chem  279 (17):17989-95.
  • Suo,Z. et al., 2007,Neurobiol Aging. 28 (12):1873-88.
  • Li,L. et al., 2008,J Neuroinflammation. 5 :24.
  • Size / Price
    Catalog:HG10839-CM
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"