Quick Order

Human INHBB Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
INHBBcDNA Clone Product Information
cDNA Size:1224
cDNA Description:ORF Clone of Homo sapiens inhibin, beta B DNA.
Gene Synonym:MGC157939, INHBB
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.


Activin and inhibin are two closely related protein complexes that have almost directly opposite biological effects. The activin and inhibin protein complexes are both dimeric in structure, and, in each complex, the two monomers are linked to one another by a single disulfide bond. Activin is composed of two ß subunits, ßA ßA (activin A), ßB ßB (activin B), or ßA ßB (activin AB). Inhibin is composed of an alpha and one of two ß subunits, ßA (inhibin A) or ßB (inhibin B). Activins are produced in many cell types and organs, such as gonads, pituitary gland, and placenta. In the ovarian follicle, activin increases FSH binding and FSH-induced aromatization. It participates in androgen synthesis enhancing LH action in the ovary and testis. In the male, activin enhances spermatogenesis. In addition, Activin plays a role in wound repair and skin morphogenesis. Activin is strongly expressed in wounded skin, and overexpression of activin in epidermis of transgenic mice improves wound healing and enhances scar formation. Activin also regulates the morphogenesis of branching organs such as the prostate, lung, and kidney. There is also evidence showed that lack of activin during development results in neural developmental defects.

  • Feng ZM, et al. (1989) Characterization and regulation of testicular inhibin beta-subunit mRNA. Mol Endocrinol. 3 (6): 939-48.
  • Bernard DJ, et al. (2002) Inhibin binding protein (InhBP/p120), betaglycan, and the continuing search for the inhibin receptor. Mol Endocrinol. 16 (2): 207-12.
  • Lejeune H, et al. (1997) Stimulating effect of both human recombinant inhibin A and activin A on immature porcine Leydig cell functions in vitro. Endocrinology. 138 (11): 4783-91.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items