After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human PRSS2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRSS2cDNA Clone Product Information
cDNA Size:744
cDNA Description:ORF Clone of Homo sapiens protease, serine, 2 (trypsin 2) DNA.
Gene Synonym:TRY2, TRY8, TRYP2, MGC111183, MGC120174, PRSS2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Mouse Trypsin-2, also known as Trypsin II, Anionic trypsinogen, Serine protease 2, PRSS2 and TRY2, is a secreted protein which belongs to the trypsin serine protease family including Trypsin, PRSS1, PRSS2 and PRSS3. It consists of a signal peptide (residues 1-15), a pro region (residues 16-23), and a proteolytically active mature chain (residues 24-247). PRSS2 contains one peptidase S1 domain. It is secreted into the duodenum, hydrolysing peptides into their smaller building blocks, which is necessary for the uptake of protein in the food. It is secreted by the pancreas in the form of inactive zymogen, trypsinogen and cleaved to its active form in the small intestine when the pancreas is stimulated by cholecystokinin through the common activation mechanism.

  • Rawlings, N.D. et al.,1994, Meth. Enzymol. 244: 19–61.
  • Noone, P.G. et al., 2001, Gastroenterology. 121 (6): 1310-9.
  • Leiros, H.K. et al., 2004, Protein Sci. 13 (4): 1056–70.
  • Rónai,Z. et al., 2009, Biochem J. 418 (1):155-61.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items