Quick Order

Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAP3K8cDNA Clone Product Information
cDNA Size:1404
cDNA Description:ORF Clone of Homo sapiens mitogen-activated protein kinase kinase kinase 8 DNA.
Gene Synonym:COT, EST, ESTF, TPL2, Tpl-2, c-COT, FLJ10486
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10800-ACG$325
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10800-ACR$325
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10800-ANG$325
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10800-ANR$325
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10800-CF$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10800-CH$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10800-CM$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10800-CY$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone)HG10800-M$95
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10800-M-F$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, His-taggedHG10800-M-H$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10800-M-N$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10800-NF$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10800-NH$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10800-NM$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10800-NY$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10800-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Mitogen-activated protein kinase kinase kinase 8, also known as Cancer Osaka thyroid oncogene, Proto-oncogene c-Cot, Serine/threonine-protein kinase cot, Tumor progression locus 2 and MAP3K8, is a cytoplasm protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase kinase subfamily. MAP3K8 is expressed in several normal tissues and human tumor-derived cell lines. Isoform 1 of MAP3K8 is activated specifically during the S and G2/M phases of the cell cycle. MAP3K8 is required for TLR4 activation of the MEK/ERK pathway. It is able to activate NF-kappa-B 1 by stimulating proteasome-mediated proteolysis of NF-kappa-B 1/p105. MAP3K8 plays a role in the cell cycle. The longer form has some transforming activity, although it is much weaker than the activated cot oncoprotein. MAP3K8 oncogene linked to human endometrial carcinoma suggesting that it may be another molecule involved in human endometrial cancer. MAP3K8 may also be an important mediator of intracellular mechanotransduction in human bone marrow-derived mesenchymal stem cells (MSCs).

  • Clark,A.M. et al., 2004, Genes Chromosomes Cancer. 41 (2):99-108.
  • Chan,H. et al., 2005, Biochem Biophys Res Commun. 328 (1):198-205.
  • Aparecida Alves,C. et al., 2006, Eur J Gynaecol Oncol. 27 (6):589-93.
  • Mielke,L.A. et al., 2009, J Immunol. 183 (12):7984-93.
  • Glossop,J.R. et al., 2009,Gene Expr Patterns  9 (5):381-8. 
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items