Quick Order

Text Size:AAA

Human CLMP / ASAM Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CLMPcDNA Clone Product Information
Gene_bank_ref_id:NM_024769.2
cDNA Size:1122
cDNA Description:ORF Clone of Homo sapiens adipocyte-specific adhesion molecule DNA.
Gene Synonym:ASAM, ACAM, CLMP, FLJ22415
Species:Human
Vector:pCMV3-C-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
 
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Human CLMP / ASAM Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged on other vectors
Related Products
Product nameProduct name
Background

Adipocyte-specific adhesion molecule (ASAM), also known as ACAM and CLMP, is a type I transmembrane protein and a member of the CTX (cortical thymocyte marker in Xenopus) family within the immunoglobulin superfamily. ASAM protein is highly expressed in the small intestine and placenta, and is found at intermediate levels in the heart, skeletal muscle, colon, spleen, kidney, and lung, and appears in low levels in the liver and peripheral blood leukocytes as well. ASAM is a transmembrane component of tight junctions in epithelial cells that can mediate cell aggregation and regulate transepithelial resistance across polarized epithelial cells. In addition, its expression is strongly correlated with white adipose tissue (WAT) mass of human and rodents with obesity.

References
  • Eguchi J, et al. (2005) Identification of adipocyte adhesion molecule (ACAM), a novel CTX gene family, implicated in adipocyte maturation and development of obesity. Biochem J. 387(Pt 2): 343-53.
  • Sze KL, et al. (2008) Expression of CLMP, a novel tight junction protein, is mediated via the interaction of GATA with the Kruppel family proteins, KLF4 and Sp1, in mouse TM4 Sertoli cells. J Cell Physiol. 214(2): 334-44.
  • Sze KL, et al. (2008) Post-transcriptional regulation of CLMP mRNA is controlled by tristetraprolin in response to TNFalpha via c-Jun N-terminal kinase signalling. Biochem J. 410(3): 575-83.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"