Quick Order

Text Size:AAA

Human PKC delta / PRKCD ORF mammalian expression plasmid, C-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PRKCD cDNA Clone Product Information
NCBI RefSeq:NM_006254.3
RefSeq ORF Size:2031bp
cDNA Description:Full length Clone DNA of Homo sapiens protein kinase C, delta with C terminal Myc tag.
Gene Synonym:MAY1, PKCD, MGC49908, nPKC-delta
Species:Human
Vector:pCMV3-C-Myc
Plasmid:pCMV3-PRKCD-myc
Restriction Site:KpnI + XbaI (6kb + 2.08kb)
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for three point mutations: 1441 C/T, 1782 C/G and 1857 T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human PRKCD Gene Plasmid Map
Human PKC delta / PRKCD Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
References
  • Cross T, et al. (2000) PKC-delta is an apoptotic lamin kinase. Oncogene. 19(19): 2331-7.
  • Song JS, et al. (1998) Tyrosine phosphorylation-dependent and -independent associations of protein kinase C-delta with Src family kinases in the RBL-2H3 mast cell line: regulation of Src family kinase activity by protein kinase C-delta. Oncogene. 16(26): 3357-68.
  • Shanmugam M, et al. (1998) Association of PKC delta and active Src in PMA-treated MCF-7 human breast cancer cells. Oncogene. 16(13): 1649-54.
  • Size / Price
    Catalog: HG10769-CM
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"